The Potential Contribution of microRNAs in Anti-cancer Effects of Aurora Kinase Inhibitor (AZD1152-HQPA)

Ali Zekri1,2 • Yashar Mesbahi3,4 • Elham Boustanipour5 • Zahra Sadr5 • Seyed H. Ghaffari3,6,7

Received: 15 April 2018 / Accepted: 10 July 2018
Ⓒ Springer Science+Business Media, LLC, part of Springer Nature 2018
Ali Zekri and Yashar Mesbahi contributed equally to this work.

* Seyed H. Ghaffari [email protected]

1 Cellular and Molecular Research Center, Iran University of Medical Sciences, Tehran, Iran
2 Department of Medical Genetics and Molecular Biology, Faculty of Medicine, Iran University of Medical Sciences (IUMS), Tehran, Iran
3 Hematologic Malignancies Research Center, Tehran University of Medical Sciences, Tehran, Iran
4 Institute of Biochemistry and Biophysics, University of Tehran, Tehran, Iran
5 Department of Medical Genetics, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran
6 Hematology, Oncology and Stem Cell Transplantation Research Center, Tehran, Iran
7 Tehran University of Medical Sciences, Tehran, Iran

Abstract

Neuroblastoma (NB) remains the critical challenge in pediatric oncology. It has the highest rate of spontaneous regression among all human cancers. Aurora kinase B (AURKB), a crucial regulator of malignant mitosis, is involved in chromosome segregation and cytokinesis. AZD1152-HQPA (Barasertib) is a small selective inhibitor of AURKB activity and currently bears clinical assessment for several malignancies. Studies suggested that microRNAs are involved in the pathobiology and chemoresistance of neuroblastoma. In the present study, we first investigated the restrictive potentials of AZD1152-HQPA on cell viability, colony formation, nucleus morphology, polyploidy, and cell-cycle distribution. We then studied the expressions level of 88 cancer-related miRNAs in untreated and AZD1152-HQPA-treated NB cell line (SK-N-MC) by real-time PCR using miRNA cancer-array system. After normalizing, the fold change of miRNAs was calculated in the AZD1152-HQPA-treated cell as compared to untreated. Our results demonstrate that the inhibition of AURKB by AZD1152-HQPA induced potent antitumor activity, suppressed cell survival, and triggered apoptosis and polyploidy in NB cells. AZD1152-HQPA, at a relevant concentration, modulated a substantial number of cancer-related miRNAs in NB cell. Interestingly, by screening the literature, among the 7 top AZD1152-HQPA-induced upregulated miRNAs (> 3-fold change; P < 0.01), all were potential tumor suppressors associated with cell apoptosis and cycle arrest, as well as inhibition of angiogenesis, invasion, and metastasis, while two downregulated miRNAs were known to have oncogenic function. Taken together, our study showed for the first time the potential contribution of miRNAs in the anti-cancer effects of AZD1152-HQPA.

Keywords Neuroblastoma . Aurora kinase B . AZD1152-HQPA . MicroRNAs . Polyploidy

Introduction

Neuroblastoma (NB) is one of the most common and fatal extracranial solid tumors in children and infants (Castleberry et al. 1997), although the development of wide range of therapeutic approaches including chemotherapy, radiation thera- py, and resection are still complicated to cure advanced-stage tumors of NB tumors (Wagner and Danks 2009). The 5-year survival rate for high-risk NB in children is around 40% to 50%. The failure of the current regimen in the treatment of NB is due to the remarkably high rate of spontaneous regression, rapid progression, and resistance to therapies which leads to the poor prognosis of the disease (Brodeur 2003; Morozova et al. 2010). Therefore, novel strategies are urgently needed to enhance the outcome of the NB treatment.
Auroras are a family of serine/threonine kinases consisting of highly conserved Aurora A, Aurora B, and Aurora C in human, participating in multiple mitotic events (Carmena and Earnshaw 2003). Aurora B (AURKB) is a chromosomal passenger protein and plays an essential role as a safeguard in the mitosis spindle assembly (Hu et al. 2000). It mediates different processes including chromosome segregation, cyto- kinesis, and H3 histone phosphorylation (Adams et al. 2001). The aberrant expression of AURKB has been reported in dif- ferent human tumors including glioblastoma multiform (Zeng et al. 2007) and lung (Smith et al. 2005) and colon cancer (Bischoff et al. 1998). Growing body of literatures indicates that the targeting of aurora kinases is beneficial for the treat- ment of drug-resistant neuroblastoma (Michaelis et al. 2014). A broad range of Aurora kinase inhibitors has shed light on molecular targets in cancer treatments (Macarulla et al. 2008). Among them, AZD1152 is a prodrug and is rapidly converted to an active AZD1152-hydroxyquinazoline-pyrazolanilide (AZD1152-HQPA) in plasma (Mortlock et al. 2007). AZD1152-HQPA is a selective and potent inhibitor of AURKB (Ki = 0.36 nmol/L) (Ducat and Zheng 2004). We re- cently demonstrated that this drug is highly useful in the treat- ment of APL (acute promyelocytic leukemia) and prostate can- cer (Ghanizadeh-Vesali et al. 2016; Zekri et al. 2015). Moreover, phase I/II clinical trials are being evaluated currently in myelogenous leukemia (Goff et al. 2012) and solid tumors (Schwartz et al. 2013). We previously demonstrated the anti- cancer mechanisms of AZD1152-HQPA which was mediated by the generation of reactive oxygen species (ROS) (Zekri et al. 2017). However, only few studies have reported the impact of AZD1152-HQPA on epigenetics such as DNA methylation and microRNA (miRNA) expression. miRNAs are one of the most important mediators of tumorigenesis which participate in dif- ferent cellular processes including proliferation, cell-cycle reg- ulation, apoptosis, differentiation, and metastasis (Kloosterman and Plasterk 2006). It is estimated that miRNAs regulate more than 60% of protein-coding genes in the human genome (Friedman et al. 2009). Thus, it may be promising to unravel the molecular mechanisms of chemotherapeutic agents by scrutinizing microRNA expression pattern.
In the current study, we investigated the effect of AZD1152-HQPA as an inhibitor of Aurora kinase B, on the expression pattern of 88 cancer-related miRNAs in SK-N-MC cell line. For the first time, we show that antitumor activity of AZD1152-HQPA can be mediated through alteration in miRNA expression.

Materials and Methods

Cell Lines and Reagents
SK-N-MC (neuroblastoma) cells were obtained from the National Cell Bank of Iran, Pasteur Institute of Iran (Tehran, Iran). Cells were cultured in RPMI 1640 medium Gibco (USA Grand Island), supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin in a humidified cham- ber with 5% of CO2 at 37 °C. Cells were harvested with 0.25% trypsin–0.03% EDTA. AZD1152-HQPA was provided by AstraZeneca Pharmaceuticals (Macclesfield, UK) and stock solutions were prepared in 100% dimethyl sulfoxide (DMSO, Merck KGaA, Darmstadt, Germany) and stored at −20 °C to produce 10 mM stock concentration. An equal volume of DMSO was added to the untreated control samples, in which the final concentration of DMSO did not exceed more than 0.1% of the total volume.

Trypan Blue Exclusion Test of Cell Viability
SK-N-MC cells were treated with different concentrations of AZD1152-HQPA for 48 h. The harvested cell was then re- suspended in phosphate-buffered saline (PBS) and incubated with trypan blue (Invitrogen) for 7 min. Neubauer hemocy- tometer was used to count live colorless cells, and the percent- age of the viable cells were calculated as viability (%) = viable cell count/total cell count × 100.

Colony Formation Assay
Long-term survival and the strength of colony generation were performed by clonogenic assay. About 75 cells/well of SK-N-MC cells were seeded in a six-well plate and incubated for 24 h. After a 48-h treatment with different concentrations of AZD1152-HQPA, cells were revived with fresh media and incubated for 2 weeks until visible and distinct colonies were formed. Finally, the cells were washed with 500 μl of PBS three times and were stained with a solution including crystal violet (0.5% w/v) and glutaraldehyde (6% v/v).

Cell-Cycle Distribution
In this experiment, DNA content was assessed by propidium iodide (Invitrogen, Carlsbad, California, USA). The treated cells were washed with PBS, fixed with ice-cold 70% ethanol, and kept overnight at − 20 °C. Cells were stained with a solu- tion containing RNase 100 μg/mL (Sigma), propidium iodide 50 μg/mL, and 0.05% Triton X-100. The flow cytometric DNA histogram was plotted to disseminate the diploid and polyploid cells by the Partec PASIII flow cytometry, Germany. Finally, Windows™ FloMax® software was uti- lized for data interpretation and graph illustration.

Morphological Change Analysis
The micronuclei formation, polyploidy, and morphological alterations were evaluated by fluorescence microscopy. Sufficient proportion of cells was seeded in a six-well plate. The cells were treated cells and fixed with ice-cold methanol and stained with Giemsa. The stained cells were centrifuged and re-suspended in hypotonic solution (0.075 M KCl) and then fixed again with a fixation solution containing methanol/ acetic acid (3:1 v/v). After fixation, cells were applied to an by RT2 miRNA PCR array human cancer (SABiosciences). Quantitative RT-PCR was performed on the Step One Plus real-time PCR system apparatus (Applied Biosystems) as de- scribed previously (Ghaffari et al. 2012; Shidfar et al. 2015). Briefly, master mix was prepared according to the manufac- turer’s instruction containing 1× RT2 SYBR Green/ROX PCR master mix (SABiosciences) and synthesized cDNA (150 ng microRNA equivalent); it was then divided into a 96-array plate (20 μl/well). Each well contained 15 ng of the synthe- sized cDNA, a set of microRNA-specific forward assay prim- er and universal reverse primer, and 10 μl SYBR green master mix in a total reaction volume of 20 μl. PCR protocols were performed for 10 min at 95 °C followed by 40 cycles of 95 °C for 15 s, 60 °C for 30 s, and 72 °C for 30 s. Melting curve analyses were evaluated to validate the specificity of all primers. The relative gene expression level of each miRNA was assessed by applying the comparative threshold cycle (Ct) method as normalized to the average Ct value of three house-

AZD1152-HQPA concentration (nM)
Fig. 1 Effect of AZD1152-HQPA on cell viability and survival. a The cytotoxic effects of AZD1152-HQPA on SK-N-MC cells were evaluated using trypan blue exclusion assay after 48-h treatment. b The inhibitory effect of AZD1152-HQPA on long-term survival of SK-N-MC cells was evaluated by colony formation assay. Statistical significance was defined at *P < 0.05 and **P < 0.01 compared to the untreated control cells. Values are given as mean ± SD. An equal volume of DMSO was added to the untreated control samples, in which the final concentration of DMSO did not exceed more than 0.1% of the total volume air-dried microscope slide and stained with diamidino phenylindole (DAPI, Invitrogen, Carlsbad, California, USA). Photographs and visualization were obtained with an Olympus IX81 fluorescence microscope. Micronuclei forma- tion and morphological changes were investigated with the scoring criteria of the HUMN project (Fenech 2000).

RNA Extraction and cDNA Synthesis
Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA). A two-step procedure was utilized to isolate miRNAs using RT2 qPCR-grade miRNA isolation kit (SABiosciences Corporation, MD, USA) following the man- ufacturer’s instructions. The quantity of RNA sample was assessed spectrophotometrically using Nanodrop ND-1000 (Nanodrop Technologies, Wilmington, DE, USA). To synthe- size complementary DNA (cDNA), 400 ng of the enriched miRNA samples were poly-adenylated, elongated, and re- verse transcribed in a one-step reaction using the RT2 miRNA first strand kit (SABiosciences).

Quantitative Real-time PCR
Real-time PCR was applied to profile the expression of miRNAs in SK-N-MC treated cells. A 96-well plate was used keeping genes including U6, SNORD47, and SNORD48. Fold change of each miRNA was calculated from the expres- sion levels between the AZD1152-HQPA-treated and - untreated cells using the 2−ΔΔCt method in the data template provided by the manufacturer (SABiosciences).

Results

AZD1152-HQPA Exposure Suppresses Viability and Long-Term Growth of SK-N-MC Cells
The cytotoxicity and anti-growth effects of AZD1152-HQPA on SK-N-MC cells were determined by the trypan blue cell counting method. The assay indicates that AZD1152-HQPA effectively decreases the viability of SK-N-MC cells in a dose- dependent manner with an IC50 of around 420 nM (Fig. 1a). Moreover, to investigate whether exposure to the AZD1152- HQPA could suppress the long-term growth of the SK-N-MC cells, anchorage-dependent colony forming assay was used. Treated cells with desired concentrations of AZD1152-HQPA illustrated a dose-dependent reduction in the surviving frac- tion with a similar IC50 to the cell count (Fig. 1b). Overall, AZD1152-HQPA could inhibit survival and growth of the NB cells.
AZD1152-HQPA Induces Polyploidy and Giant Polynucleated Cells Through Mitotic Catastrophe in SK-N-MC Cells
AZD1152-HQPA treatment led to morphological alterations in SK-N-MC cells with a noticeable increase in its size com- pared to the untreated control cells. Moreover, flow cytometric analysis of forward scatter (FSC) and side scatter (SSC) con- firmed cell enlargement and increase in cell granularity
Fig. 2 Effect of AZD1152-HQPA on cellular and nuclear morphology. a SK-N-MC cells were treated with AZD1152- HQPA (at indicated concentrations) for 48 h. Giemsa staining was used to evaluate cell morphology under a light microscope (magnification × 40). b Treated SK-N-MC cells were stained with DAPI and were analyzed by fluorescence microscopy (magnification × 100). Some hallmarks of mitotic catastrophe including micronuclei (thick arrow), nuclear buds (thin arrow), and multinucleated cells (small triangle) were detected
(Fig. 3b). FSC signal is relative to the diameter of the cell. Cellular elements that increase SSC intensity include granules and the nucleus. As represented in Giemsa staining, numerous multinucleated giant cells were observed in the treated cells compared to the untreated controls (Fig. 2a). Fluorescent mi- croscopy and DAPI staining were used to uncover nuclear structures in depth. Nuclear enlargement, polyploidy, nuclear buds, and micronuclei were observed after the treatment with AZD1152-HQPA (Fig. 2b). These features are most likely indicative of mitotic catastrophe.
Polyploidy and cytokinesis were confirmed by the flow cytometric analysis of DNA content in the treated and untreat- ed cells. Proportions of diploid and polyploid cells derived from the peak analysis of histograms were then plotted for each concentration of AZD1152-HQPA. Polypoid cells (8 N, 16 N, and 32 N) appeared at 500 nM of AZD1152-HQPA, and they were then increased in a concentration-dependent manner (Fig. 3 a, c, d); hence, this concentration of inhibitor was selected for further miRNA expression analyses. Moreover, cells with normal DNA content (2 N and 4 N) disappeared entirely at 1000 nM concentration. Collectively, AZD1152- HQPA inhibited cytokinesis and triggered polyploidy in NB cells followed by genomic instability and consequent morpho- logical abnormalities.

Basal Gene Expression Profile of miRNAs in SK-N-MC Cells
The relative expression of 88 miRNAs in the untreated SK-N- MC cells was normalized to the average Ct value of three housekeeping genes (U6, SNORD47, and SNORD48), and they were then compared to the relative expression of an en- dogenous control (miR-205). As illustrated in Fig. 4, the re- sults show that there is a significant difference in the basal expression of miRs in the untreated SK-N-MC cells. We found a 7-log difference in expression levels between the low- est (miR-205) and the highest microRNA (miR-21) in the untreated cells. The most abundant miRNAs were miR-21, miR-125b, miR-16, miR-199a-3p, and miR-15b. Except for miR-16, the rest of the upregulated miRs have been reported to possess an oncogenic activity in various tumor cells which are linked to a tumor progression (Table 1). In contrast, the miRNAs with the lowest expression (miR-205, miR-335, and miR-144) are known to have tumor-suppressive effects in hu- man malignancies. The functions of these miRNAs are de- fined with more detail in the discussion. Our data suggest that the basal expressions of some miRNAs are correlated with the proliferation, survival, and invasive property of the SK-N-MC cells.

Alteration of miRNA Gene Expression in AZD1152-HQPA-Treated Cells
The induction of polyploidy and the alteration in chromosome numbers by AZD1152-HQPA can lead to changes in the gene dosage and consequently can cause an alteration in the expres- sion of miRNAs. After 48 h of treatment with 500 nM of AZD1152-HQPA, we identified a substantial number of miRNAs that were differentially expressed miRNAs in the SK-N-MC cells. The mean log2 ratio of the fold changes was determined and plotted against the corresponding t test P values to construct a Bvolcano plot.^ The volcano plot dis- plays positions of essential miRNAs based on their level of significance (Y-axes) versus fold change in the expression lev- el (X-axes) (Fig. 5). miRNAs with more significance appear closer to the top of the plot, while miRNAs with more over- expression or downregulation are closer to the right or left sides, respectively.
The difference of more than 2-fold change in the miRNA expression (vertical dashed lines) with a cutoff at P < 0.05

Fig. 3 Effect of AZD1152-HQPA on DNA content of SK-N-MC
cells. a SK-N-MC cells were treated with different concentrations of AZD1152- HQPA. The DNA content was measured using flow cytometry and propidium iodide (PI) staining. The cell count (Y-axes) plotted against PI fluorescence intensity (X-axes) on a logarithmic scale that shows rightward shift in the fluorescence intensity histogram indicating the appearance of polyploid cells (8 N, 16 N, and 32 N cells). Peaks were analyzed by Partec PASIII FloMax software. b Dot plot images of FSC (X-axis) versus SSC (Y-axis) were depicted for untreated and treated cells.
AZD1152-HQPA treatment leads to an increase in cell size (FSC) and cell granularity (SSC) of treated cell in a dose-dependent manner. c, d Percentages of diploid and polyploid (8 N, 16 N and 32 N) cells were assessed and plotted for different concentrations (horizontal blue line) were clarified as significant (Fig. 5). After AZD1152-HQPA treatment, the expression of 86 was altered (58 upregulation and 28 downregulated), while the expression of two miRNAs (miR-15b and miR-218) did not change (Fig. 6). However, among 86 altered miRNAs, the changes in expression of 32 miRNAs were significant. Also, among 58 upregulated miRNAs, 22 miRNAs were signifi- cantly upregulated. From the 28 downregulated miRNAs,
Fig. 4 Basal expression of miRNA in SK-N-MC cell line. miRNAs were extracted at exponential phase of cell growth and then converted to cDNA. Real-time PCR was applied to measured fold changes of miRNA expression. The fold change of miR205 was defined as 1, and the relative expression of all other miRNAs was compared to the miR- 205 expression (endogenous control). Values are given as mean ± SD ten miRNAs were significantly downregulated (Fig. 5). The most upregulated miRNAs after AZD1152-HQPA treatment were miR-203, miR-138, miR-18b, miR-363, miR-1, miR- 133b, and miR-373. miRNA-203 was the most overexpressed miRs (with 10.33-fold change) in this study with the most significant level (P value: 0.00058). On the other hand, among 28 downregulated miRNAs, only two had a significant level of downregulation including miR-149 and miR-134.
Since many miRNAs were altered by AZD1152-HQPA treatment, we only selected the most dysregulated miRNAs (9 miRNAs) with at least 3-fold difference (with P value of < 0.05) in their expression levels between treated and untreated control samples for further study. The target genes, cellular outcomes, deregulation in tumor cells, and chromosomal lo- cation of these altered miRNAs were investigated following searching the relevant literature which is shown in Table 2. It is interesting that all these nine upregulated miRNAs by the AZD1152-HQPA treatment (miR-203, miR-138, miR-18b, miR-363, miR-1, miR-133b, and miR-373) are known to have tumor and metastatic suppressor functions and associated with cell apoptosis and cycle arrest, as well as inhibition of angio- genesis, invasion, and metastasis while both downregulated miRNAs (miR-149 and miR-134) are known to have onco- genic function.

Discussion

The family of Aurora kinases is represented as potential ther- apeutic targets in drug-resistant neuroblastoma cells (Michaelis et al. 2014). The Aurora kinase B (AURKB) plays a vital role in human tumor progression (Portella et al. 2011). The amplification and overexpression of AURKB could lead to a rapid tumor cell proliferation and poor prognosis (Hegyi et al. 2012). It has been reported that the inhibition of AURKB induces potent antitumor activity in different tumors including breast (Gully et al. 2010), colon, and pancreas cancers (Azzariti et al. 2011) and also in acute myeloid leukemia (Oke et al. 2009). In the present study, the inhibition of AURKB by Barasertib (AZD1152-HQPA) induced a potent antitumor activity in NB cell line, suppressed cell survival, and triggered apoptosis and polyploidy. miRNAs are one of the most critical molecular mediators which play essential roles in the pathogenesis of human tumors by participating in different cellular processes.

Table 1 Basal constitutive expression of miRNAs in neuroblastoma cell line (SK-N-MC)
miRNAs Target genes Cellular outcomes Reference tumor cells Chromosomal location
High expression
miR-21 BTG2, HIPK3, and PDCD4 Apoptosis↓, tumor growth↑ Lung, thyroid 17q23.1
miR-125b p53, p38MAPK, and Vps4b Apoptosis ↓, aggressiveness ↑, and proliferation↑ Brain, skin 11q24.1
miR-199a-3p ZHX1 Tumor growth ↑ and apoptosis ↓ Stomach 19p13.2
miR-15b RECK Invasion ↑, tumor growth ↑, and metastasis ↑ Breast, lung 3q25.33
Low expression
miR-205 E2F1 and E2F5 Apoptosis ↓, proliferation ↑, and survival ↑ Skin 1q32.2
miR-335 Survivin Apoptosis ↓ and survival ↑ Bone 7q32.2
miR-144 ZEB1/2 Proliferation ↑, migration ↑, and apoptosis ↓ Breast 17q11.2

Previous studies have demonstrated that miRNAs regulate AURKB expression. Mäki-Jouppila suggested that excess miR let-7b reduces mRNA and protein expression of Aurora B kinase leading to mitotic defects including polyploidy and multipolarity. They suggest that the loss of let-7b can drive tumorigenesis by upregulation of Aurora B (Maki-Jouppila et al. 2015). In another study, Winsel et al. identified miR-378a- 5p as mitosis perturbing microRNA. They showed that over- expression of miR-378a-5p was associated with suppression of AURKB and induced numerical chromosome changes. Moreover, an in vivo study uncovered that overexpression of miR-378a-5p correlates with the most aggressive forms of breast cancer (Winsel et al. 2014).
Fig. 5 Volcano plot of the expression of 88 cancer-related miRNAs in AZD1152-HQPA treated versus untreated. This diagram shows the distribution of the expression of 88 miRNAs in SK-N-MC cells after treatment with AZD1152-HQPA (48 h) as compared to the untreated control. The x-axis shows a difference in the expression level on a log2 scale, whereas the y-axis denotes corresponding P values (Student’s t test) on a negative log scale. The dashed vertical lines show a threshold of 2- fold change in miRNA expression and the blue horizontal line designates the significant level of P = 0.05. Top right section of the diagram represents significantly overexpressed miRNAs, and top left section shows significantly downregulated miRNAs
Despite previous efforts, there is no study evaluating the impact of AZD1152-HQPA on the expression pattern of miRNAs. Our previous and present studies show that AZD1152-HQPA treatment leads to polyploidy and aneuploi- dy in different malignant cells (Ghanizadeh-Vesali et al. 2016; Zekri et al. 2015).
These alterations in chromosome number can lead to chang- es in gene dosage and consequently in the expression balance of miRNAs. In the present study, we investigate the alteration in the expression of miRNAs after AZD1152-HQPA treatment in a NB cell line. Firstly, we assessed the basal expression of 88 cancer-related miRNAs in the untreated SK-N-MC cells. Seven microRNA are more abundant than the others as represented in Fig. 4 and Table 1. This overexpression is almost associated with growth and proliferation of the NB cells. Also, we found that MiR-21 was the most abundant miRNAs in the untreated SK-N-MC cells; its expression was 50,000,000-fold (> 7 logs) higher than the control gene (miR 205). It has been reported that miR-21 is frequently overexpressed in different human cancers. Expression of miR-21 induces tumor growth and reduces apo- ptosis in lung and thyroid cancers (Frezzetti et al. 2011). MiR- 125b was the second most abundant miRNA in the untreated SK-N-MC cells. Similarly, this miRNA promotes tumorigene- sis, progression, and survival in skin cancer cells. Also, an overexpression of miR-125b was reported in the early stages of tumorigenesis in skin cancer (Zhang et al. 2014). Another oncogenic activity of miR-125b was reported in gliomas which inhibits cell apoptosis by blocking of p53 and p38MAPK path- ways (Wu et al. 2013). Oncogenic activity of miR199a-3p was shown in gastric cancer (GC) by targeting ZHX1. Ectopic

Fig. 6 Alteration in the expression of 88 cancer-related miRNAs after„ AZD1152-HQPA treatment compared to untreated controls. SK-N-MC cells were treated with 500 nM of AZD1152-HQPA for 48 h. Real-time PCR was used to measure the expression of miRNAs. Data are shown as
fold change of miRNA levels detected in AZD1152-HQPA-treated cells with respect to those found in the corresponding untreated controls. The relative expression normalized to the average medium of three housekeeping genes (U6, SNORD47, and SNORD48) by the 2−ΔΔCt method. Values are given as mean ± SD

Table 2 Target genes and molecular mechanism of microRNAs that were significantly* altered in SK-N-MC cells after AZD1152-HQPA treatment
miRNAs Target genes Cellular outcomes Reference tumor cells Chromosomal location
Upregulated
miR-203 Sam68, PKC , and survivin Migration ↓, proliferation ↓, and apoptosis ↑ Neuroblastoma, lung, osteosarcoma 14q32
miR-138 caspase 8 and hTERT Proliferation ↓, colony formation ↓, migration↓, and apoptosis↑ Neuroblastoma, cervical 3p21.3 and 16q13
miR-18b MDM2 proliferation ↓, tumor growth ↓, and migration ↓ Melanoma Xq26.2
miR-363 MYO1B and ADAM15 Migration ↓, transformation ↓, and tumor growth ↓ Neuroblastoma Xq26.2
miR-1 MET Proliferation ↓, migration ↓, apoptosis ↑, and tumor growth ↓ Lung cancer 20q13.33
miR-133b AKT1, BCL-W, and FSCN1 Apoptosis ↑, proliferation ↓, and migration ↓ Bladder, lung 6p12.2
miR-373 CD44 and TGFBR2 Migration ↓ and invasion ↓ Glioblastoma 19q13.42
Downregulated
miR-149 GSK3 Apoptosis ↑, proliferation ↓ Melanoma 2q37.3
miR-134 WWOX and Pod1 Survival ↑, tumor growth ↓, and metastasis ↓ Head and neck, lung cancer 14q32.31
* Significance is considered as > 3-fold change and P < 0.05 in microRNA gene expression

Table 3 Primers for microRNA-specific quantitative RT-PCR
miRNA Primer sequence miRNA Primer sequence
let-7a UGAGGUAGUAGGUUGUAUAGUU miR-21 UAGCUUAUCAGACUGAUGUUGA
miR-133b UUUGGUCCCCUUCAACCAGCUA miR-181d AACAUUCAUUGUUGUCGGUGGGU
miR-122 UGGAGUGUGACAAUGGUGUUUG miR-301a CAGUGCAAUAGUAUUGUCAAAGC
miR-20b CAAAGUGCUCAUAGUGCAGGUAG miR-200c UAAUACUGCCGGGUAAUGAUGGA
miR-335 UCAAGAGCAAUAACGAAAAAUGU miR-100 AACCCGUAGAUCCGAACUUGUG
miR-196a UAGGUAGUUUCAUGUUGUUGGG miR-10b UACCCUGUAGAACCGAAUUUGUG
miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA miR-155 UUAAUGCUAAUCGUGAUAGGGGU
miR-142-5p CAUAAAGUAGAAAGCACUACU miR-1 UGGAAUGUAAAGAAGUAUGUAU
miR-96 UUUGGCACUAGCACAUUUUUGCU miR-363 AAUUGCACGGUAUCCAUCUGUA
miR-222 AGCUACAUCUGGCUACUGGGU miR-150 UCUCCCAACCCUUGUACCAGUG
miR-148b UCAGUGCAUCACAGAACUUUGU let-7i UGAGGUAGUAGUUUGUGCUGUU
miR-92a UAUUGCACUUGUCCCGGCCUGU miR-27b UUCACAGUGGCUAAGUUCUGC
miR-184 UGGACGGAGAACUGAUAAGGGU miR-7 UGGAAGACUAGUGAUUUUGUUGU
miR-214 ACAGCAGGCACAGACAGGCAGU miR-127-5p CUGAAGCUCAGAGGGCUCUGAU
miR-15a UAGCAGCACAUAAUGGUUUGUG miR-29a UAGCACCAUCUGAAAUCGGUUA
miR-18b UAAGGUGCAUCUAGUGCAGUUAG miR-191 CAACGGAAUCCCAAAAGCAGCUG
miR-378 ACUGGACUUGGAGUCAGAAGG let-7d AGAGGUAGUAGGUUGCAUAGUU
let-7b UGAGGUAGUAGGUUGUGUGGUU miR-9 UCUUUGGUUAUCUAGCUGUAUGA
miR-205 UCCUUCAUUCCACCGGAGUCUG let-7f UGAGGUAGUAGAUUGUAUAGUU
miR-181a AACAUUCAACGCUGUCGGUGAGU miR-10a UACCCUGUAGAUCCGAAUUUGUG
miR-130a CAGUGCAAUGUUAAAAGGGCAU miR-181b AACAUUCAUUGCUGUCGGUGGGU
miR-199a-3p ACAGUAGUCUGCACAUUGGUUA miR-15b UAGCAGCACAUCAUGGUUUACA
miR-140-5p CAGUGGUUUUACCCUAUGGUAG miR-16 UAGCAGCACGUAAAUAUUGGCG
miR-20a UAAAGUGCUUAUAGUGCAGGUAG miR-210 CUGUGCGUGUGACAGCGGCUGA
miR-146b-5p UGAGAACUGAAUUCCAUAGGCU miR-17 CAAAGUGCUUACAGUGCAGGUAG
miR-132 UAACAGUCUACAGCCAUGGUCG miR-98 UGAGGUAGUAAGUUGUAUUGUU
miR-193b AACUGGCCCUCAAAGUCCCGCU miR-34a UGGCAGUGUCUUAGCUGGUUGU
miR-183 UAUGGCACUGGUAGAAUUCACU miR-25 CAUUGCACUUGUCUCGGUCUGA
miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC miR-144 UACAGUAUAGAUGAUGUACU
miR-30c UGUAAACAUCCUACACUCUCAGC miR-128a UCACAGUGAACCGGUCUCUUU
miR-148a UCAGUGCACUACAGAACUUUGU miR-143 UGAGAUGAAGCACUGUAGCUC
miR-134 UGUGACUGGUUGACCAGAGGGG miR-215 AUGACCUAUGAAUUGACAGAC
let-7g UGAGGUAGUAGUUUGUACAGUU miR-19a UGUGCAAAUCUAUGCAAAACUGA
miR-138 AGCUGGUGUUGUGAAUCAGGCCG miR-193a-5p UGGGUCUUUGCGGGCGAGAUGA
miR-373 GAAGUGCUUCGAUUUUGGGGUGU miR-18a UAAGGUGCAUCUAGUGCAGAUAG
let-7c UGAGGUAGUAGGUUGUAUGGUU miR-125b UCCCUGAGACCCUAACUUGUGA
let-7e UGAGGUAGGAGGUUGUAUAGUU miR-126 UCGUACCGUGAGUAAUAAUGCG
miR-218 UUGUGCUUGAUCUAACCAUGU miR-27a UUCACAGUGGCUAAGUUCCGC
miR-29b UAGCACCAUUUGAAAUCAGUGUU miR-372 AAAGUGCUGCGACAUUUGAGCGU
miR-146a UGAGAACUGAAUUCCAUGGGUU miR-149 UCUGGCUCCGUGUCUUCACUCCC
miR-212 UAACAGUCUCCAGUCACGGCC miR-23b AUCACAUUGCCAGGGAUUACC
miR-135b UAUGGCUUUUCAUUCCUAUGUGA miR-203 GUGAAAUGUUUAGGACCACUAG
miR-206 UGGAAUGUAAGGAAGUGUGUGG miR-32 UAUUGCACAUUACUAAGUUGCA
miR-124 UAAGGCACGCGGUGAAUGCC miR-181c AACAUUCAACCUGUCGGUGAGU

expression of miR-199a-3p potently induces proliferation of GC cell and inhibits apoptosis (Wang et al. 2014). It has been reported that miR-15b is an oncomir with a tumor-inducing activity in breast and lung cancer cells. MiR-15b triggers inva- sion, tumor growth, and metastasis by downregulating RECK mRNA in several malignancies (Loayza-Puch et al. 2010).
We have also found that some miRNAs were downregulat- ed at the basal levels in SK-N-MC cell lines. Three most downregulated miRs were miR-205, miR-335, and miR-144. Tumor-suppressive activity of miR-205 was reported in mel- anoma cells. The restoration of miR-205 decreased cell pro- liferation via downregulation of E2F1 and E2F4 (Loayza- Puch et al. 2010). Also, it is suggested that MiR-335 directly inhibits survivin in osteosarcoma (OS) cells and functions as a tumor suppressor. Transfected OS cells with miR-335 mimic potently induced apoptosis and growth arrest (Liu et al. 2016b). At last, miR-144 was observed to be downregulated in breast cancer and functions as a tumor suppressor. Also, the downregulation of mir-144 triggered epithelial-mesenchymal transition (EMT) in breast cancer (Pan et al. 2016). It seems that the basal expressions of these miRNAs in SK-N-MC cell were correlated with cell proliferation, survival, apoptosis in- hibition, metastasis, and tumorigenesis.
In the next step of our analyses, we investigated the expres- sion patterns of miRNAs in the AZD1152-HQPA-treated cells. The expression level of each miRNA relative to the untreated one shows that a significant number of cancer-related miRs were altered after AZD1152-HQPA treatment. Seven of the most upregulated miRs are known to have tumor-suppressive functions (Tables 2 and 3). MiR-203 showed the highest over- expression in SK-N-MC cells after the AZD1152-HQPA treat- ment. It has been reported that miR-203 can inhibit the malig- nant progression of neuroblastoma cells (Zhao et al. 2015). Also, another study also shows that the overexpression of mir-203 is accompanied by the reduction of cell proliferation and migration in lung cancer and osteosarcoma cells (Chen et al. 2016; Wang et al. 2013). In recent studies, it was revealed that an overexpression of miR-138 induced apoptosis in neuro- blastoma and reduced migration and invasion of cervical cancer through targeting hTERT (Chakrabarti et al. 2013; Zhou et al. 2016). Qiao et al. showed that an overexpression of miR-363 substantially declined the number of colonies and reduced me- tastasis in neuroblastoma cells (Qiao et al. 2013). miR-18b has been reported to act as a tumor suppressor in melanoma cells by blockade of MDM2 expression which leads to an upregulation of p53 and an increase apoptosis (Dar et al. 2013). There is limited evidence to elucidate the role of miR-1 in neuroblasto- ma and other cancers. However, the ectopic expression of miR- 1 declined the growth and replication of A549 cells. It also blocked migration and invasiveness in lung cancer cells in vitro (Nasser et al. 2008).
The previous study on bladder cancer indicated that a low expression of miR-133b was associated with a high-grade bladder cancer. The use of miR-133b mimic significantly re- duced cell proliferation and also increased apoptosis (Chen et al. 2014). Liu et al. showed that the overexpression of miR- 133b sensitizes lung cancer cells to the irradiation by the in- hibition of glycolysis (Liu et al. 2016a). It has been reported that miR-373 has inhibitory effect on the migration and invasion of glioma cells through the downregulation of CD44 and TGFBR2 (Wei et al. 2016).
On the other hand, miR-149 and miR-134 were the most downregulated miRs in the cells that were treated with AZD1152-HQPA. There are reports that miR-149 acts as an oncogenic factor in human cancer cells. The downregulation of miR-149 reduces cell proliferation of melanoma as a result of p53 activation (Jin et al. 2011). Various evidences show the implication of miR-134 in carcinogenesis of head and neck squamous cell carcinoma (HNSCC) (Liu et al. 2014). High expression of miR-134 was linked to nodal metastasis in HNSCC patients and acts as a predictor of poor survival. Another study showed that miR-134 is a novel EGFR- targeting miRNA in non-small-cell lung cancer (NSCLC) cell lines (Qin et al. 2016). Moreover, miR-134 was reported to play as a potent inducer for pluripotent stem cell differentia- tion. Further experiments have shown that an overexpression of miR-134 increases cell proliferation and inhibits migration and cell apoptosis (Zhang et al. 2012).
In summary, our study shows that the inhibition of AURKB by AZD1152-HQPA induced a potent antitumor ac- tivity, suppressed cell survival, and triggered apoptosis and polyploidy in a NB cell line, SK-N-MC. AZD1152-HQPA, at a relevant concentration, modulated a substantial number of cancer-related miRNAs in NB cell. The effect of AZD1152-HQPA on the expression pattern of 88 cancer- related miRNAs shows that antitumor activity of AZD1152- HQPA could be mediated through alteration in miRNA ex- pression. We may suggest that the altered expression pattern of miRNAs could be a potential mechanism underlying the anti-cancer effect of AZD1152-HQPA. Further evaluation of loss/gain-of-function assays will enlighten the exact contribu- tion of these miRNA changes in cellular functions.

Acknowledgments The authors are very grateful to AstraZeneca phar- maceutical company for providing AZD1152-HQPA.

Funding Information This work was supported by Hematologic Malignancies Research Center, Tehran University of Medical Sciences, Tehran, Iran.

Compliance with Ethical Standards
Conflict of Interest The authors declare that they have no conflict of interest.

References

Adams RR, Carmena M, Earnshaw WC (2001) Chromosomal passengers and the (aurora) ABCs of mitosis. Trends Cell Biol 11:49–54
Azzariti A et al (2011) Aurora B kinase inhibitor AZD1152: determinants of action and ability to enhance chemotherapeutics effectiveness in pancreatic and colon cancer. Br J Cancer 104:769–780. https://doi. org/10.1038/bjc.2011.21
Bischoff JR et al (1998) A homologue of Drosophila aurora kinase is oncogenic and amplified in human colorectal cancers. EMBO J 17:3052–3065. https://doi.org/10.1093/emboj/17.11.3052
Brodeur GM (2003) Neuroblastoma: biological insights into a clinical enigma. Nat Rev Cancer 3:203–216. https://doi.org/10.1038/ nrc1014
Carmena M, Earnshaw WC (2003) The cellular geography of aurora kinases. Nat Rev Mol Cell Biol 4:842–854. https://doi.org/10. 1038/nrm1245
Castleberry RP et al (1997) The International Neuroblastoma Risk Groups (INRG): a preliminary report. Eur J Cancer 33:2113–2116
Chakrabarti M, Banik NL, Ray SK (2013) miR-138 overexpression is more powerful than hTERT knockdown to potentiate apigenin for apoptosis in neuroblastoma in vitro and in vivo. Exp Cell Res 319: 1575–1585. https://doi.org/10.1016/j.yexcr.2013.02.025
Chen XN et al (2014) MiR-133b regulates bladder cancer cell prolifera- tion and apoptosis by targeting Bcl-w and Akt1. Cancer Cell Int 14: 70. https://doi.org/10.1186/s12935-014-0070-3
Chen X et al (2016) MiR-34a and miR-203 inhibit survivin expression to control cell proliferation and survival in human osteosarcoma cells. J Cancer 7:1057–1065. https://doi.org/10.7150/jca.15061
Dar AA et al (2013) The role of miR-18b in MDM2-p53 pathway sig- naling and melanoma progression. J Natl Cancer Inst 105:433–442. https://doi.org/10.1093/jnci/djt003
Ducat D, Zheng Y (2004) Aurora kinases in spindle assembly and chro- mosome segregation. Exp Cell Res 301:60–67. https://doi.org/10. 1016/j.yexcr.2004.08.016
Fenech M (2000) The in vitro micronucleus technique. Mutat Res 455: 81–95
Frezzetti D et al (2011) Upregulation of miR-21 by Ras in vivo and its role in tumor growth. Oncogene 30:275–286. https://doi.org/10. 1038/onc.2010.416
Friedman RC, Farh KK, Burge CB, Bartel DP (2009) Most mammalian mRNAs are conserved targets of microRNAs. Genome Res 19:92– 105. https://doi.org/10.1101/gr.082701.108
Ghaffari SH, Bashash D, Dizaji MZ, Ghavamzadeh A, Alimoghaddam K (2012) Alteration in miRNA gene expression pattern in acute promyelocytic leukemia cell induced by arsenic trioxide: a possible mechanism to explain arsenic multi-target action. Tumour Biol 33: 157–172. https://doi.org/10.1007/s13277-011-0259-1
Ghanizadeh-Vesali S et al (2016) Significance of AZD1152 as a potential treatment against Aurora B overexpression in acute promyelocytic leukemia. Ann Hematol 95:1031–1042. https://doi.org/10.1007/ s00277-016-2670-6
Goff LWet al (2012) Phase I study of oral irinotecan as a single-agent and given sequentially with capecitabine. Investig New Drugs 30:290– 298. https://doi.org/10.1007/s10637-010-9528-x
Gully CP et al (2010) Antineoplastic effects of an Aurora B kinase inhib- itor in breast cancer. Mol Cancer 9:42. https://doi.org/10.1186/1476- 4598-9-42
Hegyi K, Egervari K, Sandor Z, Mehes G (2012) Aurora kinase B ex- pression in breast carcinoma: cell kinetic and genetic aspects. Pathobiology 79:314–322. https://doi.org/10.1159/000338082
Hu HM, Chuang CK, Lee MJ, Tseng TC, Tang TK (2000) Genomic organization, expression, and chromosome localization of a third Aurora-related kinase gene, Aie1. DNA Cell Biol 19:679–688. https://doi.org/10.1089/10445490050199063
Jin L et al (2011) MicroRNA-149*, a p53-responsive microRNA, func- tions as an oncogenic regulator in human melanoma. Proc Natl Acad Sci 108:15840–15845. https://doi.org/10.1073/pnas.1019312108
Kloosterman WP, Plasterk RH (2006) The diverse functions of microRNAs in animal development and disease. Dev Cell 11:441– 450. https://doi.org/10.1016/j.devcel.2006.09.009
Liu CJ, Shen WG, Peng SY, Cheng HW, Kao SY, Lin SC, Chang KW (2014) miR-134 induces oncogenicity and metastasis in head and neck carcinoma through targeting WWOX gene. Int J Cancer 134: 811–821. https://doi.org/10.1002/ijc.28358
Liu G, Li YI, Gao X (2016a) Overexpression of microRNA-133b sensi- tizes non-small cell lung cancer cells to irradiation through the inhi- bition of glycolysis. Oncol Lett 11:2903–2908. https://doi.org/10. 3892/ol.2016.4316
Liu ZF et al (2016b) MiR-335 functions as a tumor suppressor and reg- ulates survivin expression in osteosarcoma. Eur Rev Med Pharmacol Sci 20:1251–1257
Loayza-Puch F, Yoshida Y, Matsuzaki T, Takahashi C, Kitayama H, Noda M (2010) Hypoxia and RAS-signaling pathways converge on, and cooperatively downregulate, the RECK tumor-suppressor protein through microRNAs. Oncogene 29:2638–2648. https://doi.org/10. 1038/onc.2010.23
Macarulla T, Ramos FJ, Tabernero J (2008) Aurora kinase family: a new target for anticancer drug. Recent Pat Anticancer Drug Discov 3: 114–122
Maki-Jouppila JH et al (2015) MicroRNA let-7b regulates genomic bal- ance by targeting Aurora B kinase. Mol Oncol 9:1056–1070. https:// doi.org/10.1016/j.molonc.2015.01.005
Michaelis M et al (2014) Aurora kinases as targets in drug-resistant neu- roblastoma cells. PLoS One 9:e108758. https://doi.org/10.1371/ journal.pone.0108758
Morozova O et al (2010) System-level analysis of neuroblastoma tumor- initiating cells implicates AURKB as a novel drug target for neuro- blastoma. Clin Cancer Res 16:4572–4582. https://doi.org/10.1158/ 1078-0432.ccr-10-0627
Mortlock AA et al (2007) Discovery, synthesis, and in vivo activity of a new class of pyrazoloquinazolines as selective inhibitors of aurora B kinase. J Med Chem 50:2213–2224. https://doi.org/10.1021/ jm061335f
Nasser MW et al (2008) Down-regulation of micro-RNA-1 (miR-1) in lung cancer. Suppression of tumorigenic property of lung cancer cells and their sensitization to doxorubicin-induced apoptosis by miR-1. J Biol Chem 283:33394–33405. https://doi.org/10.1074/ jbc.M804788200
Oke A et al (2009) AZD1152 rapidly and negatively affects the growth and survival of human acute myeloid leukemia cells in vitro and in vivo. Cancer Res 69:4150–4158. https://doi.org/10.1158/0008- 5472.CAN-08-3203
Pan Y, Zhang J, Fu H, Shen L (2016) miR-144 functions as a tumor suppressor in breast cancer through inhibiting ZEB1/2-mediated ep- ithelial mesenchymal transition process. Onco Targets Ther 9:6247– 6255. https://doi.org/10.2147/OTT.S103650
Portella G, Passaro C, Chieffi P (2011) Aurora B: a new prognostic marker and therapeutic target in cancer. Curr Med Chem 18:482– 496
Qiao J et al (2013) miR-335 and miR-363 regulation of neuroblastoma tumorigenesis and metastasis. Surgery 154:226–233. https://doi.org/ 10.1016/j.surg.2013.04.005
Qin Q, Wei F, Zhang J, Wang X, Li B (2016) miR-134 inhibits non-small cell lung cancer growth by targeting the epidermal growth factor receptor. J Cell Mol Med 20:1974–1983. https://doi.org/10.1111/ jcmm.12889
Schwartz GK et al (2013) Phase I study of barasertib (AZD1152), a selective inhibitor of Aurora B kinase, in patients with advanced solid tumors. Investig New Drugs 31:370–380. https://doi.org/10. 1007/s10637-012-9825-7
Shidfar F, Ghaffari SH, Tavoosidana G, Hosseini E, Alimoghaddam K, Ghavamzadeh A (2015) Arsenic trioxide alters the MicroRNA ex- pression profile of U87 glioblastoma. Anti Cancer Agents Med Chem 16:247–258
Smith SL et al (2005) Overexpression of aurora B kinase (AURKB) in primary non-small cell lung carcinoma is frequent, generally driven from one allele, and correlates with the level of genetic instability. Br J Cancer 93:719–729. https://doi.org/10.1038/sj.bjc.6602779
Wagner LM, Danks MK (2009) New therapeutic targets for the treatment of high-risk neuroblastoma. J Cell Biochem 107:46–57. https://doi. org/10.1002/jcb.22094
Wang C et al (2013) miR-203 inhibits cell proliferation and migration of lung cancer cells by targeting PKCalpha. PLoS One 8:e73985. https://doi.org/10.1371/journal.pone.0073985
Wang Z et al (2014) MiR-199a-3p promotes gastric cancer progression by targeting ZHX1. FEBS Lett 588:4504–4512. https://doi.org/10. 1016/j.febslet.2014.09.047
Wei F, Wang Q, Su Q, Huang H, Luan J, Xu X, Wang J (2016) miR-373 inhibits glioma cell U251 migration and invasion by down- regulating CD44 and TGFBR2. Cell Mol Neurobiol 36:1389– 1397. https://doi.org/10.1007/s10571-016-0338-3
Winsel S et al (2014) Excess of miRNA-378a-5p perturbs mitotic fidelity and correlates with breast cancer tumourigenesis in vivo. Br J Cancer 111:2142–2151. https://doi.org/10.1038/bjc.2014.524
Wu N et al (2013) MiR-125b acts as an oncogene in glioblastoma cells and inhibits cell apoptosis through p53 and p38MAPK-independent pathways. Br J Cancer 109:2853–2863. https://doi.org/10.1038/bjc. 2013.672
Zekri A et al (2015) AZD1152-HQPA induces growth arrest and apopto- sis in androgen-dependent prostate cancer cell line (LNCaP) via producing aneugenic micronuclei and polyploidy. Tumour Biol 36: 623–632. https://doi.org/10.1007/s13277-014-2664-8
Zekri A, Mesbahi Y, Ghanizadeh-Vesali S, Alimoghaddam K, Ghavamzadeh A, Ghaffari SH (2017) Reactive oxygen speciesgeneration and increase in mitochondrial copy number: new insight into the potential mechanism of cytotoxicity induced by aurora ki- nase inhibitor, AZD1152-HQPA. Anti- Drugs 28:841–851. https://doi.org/10.1097/CAD.0000000000000523
Zeng WF, Navaratne K, Prayson RA, Weil RJ (2007) Aurora B expres- sion correlates with aggressive behaviour in glioblastoma multiforme. J Clin Pathol 60:218–221. https://doi.org/10.1136/jcp. 2006.036806
Zhang X, Wang H, Zhang S, Song J, Zhang Y, Wei X, Feng Z (2012) MiR-134 functions as a regulator of cell proliferation, apoptosis, and migration involving lung septation. In Vitro Cell Dev Biol Anim 48: 131–136. https://doi.org/10.1007/s11626-012-9482-3
Zhang L, Ge Y, Fuchs E (2014) miR-125b can enhance skin tumor initi- ation and promote malignant progression by repressing differentia- tion and prolonging cell survival. Genes Dev 28:2532–2546. https:// doi.org/10.1101/gad.248377.114
Zhao D, Tian Y, Li P, Wang L, Xiao A, Zhang M, Shi T (2015) MicroRNA-203 inhibits the malignant progression of neuroblasto- ma by targeting Sam68. Mol Med Rep 12:5554–5560. https://doi. org/10.3892/mmr.2015.4013
Zhou N, Fei D, Zong S, Zhang M, Yue Y (2016) MicroRNA-138 inhibits proliferation, migration and invasion through targeting hTERT in cervical cancer. Oncol Lett 12:3633–3639. https://doi.org/10.3892/ ol.2016.5038